Sample ID: MP23-0431_rbcL
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:16 |
| Analysis completed | 2025-05-03 01:28:16 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Planta. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Planta | |
| Coverage of species in genus Planta | |
| Coverage of species in genus Planta in country of origin Indonesia |
Flag 5.1C:
The reference data are likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Planta at the given locus rbcL.
Global occurrence records for Planta.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The reference data offers little support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
Flag 5.3C:
It’s unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample’s country of origin
Reasoning: No species in genus have been observed in the country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
| Locus | rbcL |
| Preliminary ID | Planta |
| Taxa of interest |
Nicotiana tabacum |
| Country | Indonesia |
| Host | NA |
| Sample ID | MP23-0431_rbcL |
| Query DNA sequence |
>MP23-0431_rbcL GTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACC AAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCAC CTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTAT GGACCGATGGACTTACCAGYCTTGATCGTTACAAAGGACGATGCTACCGCATCGAGCGTG TTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAG AAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCC TGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAG GTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGT TGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTT ATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAAC CATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGG CTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAA TGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACT TAACGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACT TCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCA CTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCT
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 499 | 197 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Nicotiana sylvestris | 2 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana sylvestrisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana knightiana | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana knightianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana tabacum | 13 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana tabacumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana paniculata | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana paniculataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana rustica | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana rusticaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana glauca | 2 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana glaucaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana attenuata | 3 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana attenuataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana suaveolens | 1 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana suaveolensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana amplexicaulis | 1 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana amplexicaulisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana benthamiana | 1 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana benthamianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis viscosa | 1 | 99.5% | 0.0 |
Database coverage of Candidate Anthocercis viscosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana debneyi | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana debneyiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Plastid transformation vector pLEV IR-coS | 1 | 99.5% | 0.0 |
Database coverage of Candidate Plastid transformation vector pLEV IR-coSThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Trompettia cardenasiana | 1 | 99.4% | 0.0 |
Database coverage of Candidate Trompettia cardenasianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana acuminata | 1 | 99.4% | 0.0 |
Database coverage of Candidate Nicotiana acuminataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Atropa belladonna | 5 | 99.4% | 0.0 |
Database coverage of Candidate Atropa belladonnaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Cuscuta compacta | 1 | 99.4% | 0.0 |
Database coverage of Candidate Cuscuta compactaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora officinarum | 3 | 99.4% | 0.0 |
Database coverage of Candidate Mandragora officinarumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora turcomanica | 1 | 99.4% | 0.0 |
Database coverage of Candidate Mandragora turcomanicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana plumbaginifolia | 1 | 99.4% | 0.0 |
Database coverage of Candidate Nicotiana plumbaginifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana obtusifolia | 1 | 99.4% | 0.0 |
Database coverage of Candidate Nicotiana obtusifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Scopolia carniolica | 2 | 99.4% | 0.0 |
Database coverage of Candidate Scopolia carniolicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum sisymbriifolium | 3 | 99.3% | 0.0 |
Database coverage of Candidate Solanum sisymbriifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| synthetic construct | 1 | 99.3% | 0.0 |
Database coverage of Candidate synthetic constructThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Scopolia parviflora | 1 | 99.3% | 0.0 |
Database coverage of Candidate Scopolia parvifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycianthes radiata | 1 | 99.3% | 0.0 |
Database coverage of Candidate Lycianthes radiataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana undulata | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana undulataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana tomentosiformis | 3 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana tomentosiformisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anisodus luridus | 1 | 99.3% | 0.0 |
Database coverage of Candidate Anisodus luridusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora autumnalis | 1 | 99.3% | 0.0 |
Database coverage of Candidate Mandragora autumnalisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Hyoscyamus niger | 2 | 99.3% | 0.0 |
Database coverage of Candidate Hyoscyamus nigerThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physochlaina physaloides | 1 | 99.3% | 0.0 |
Database coverage of Candidate Physochlaina physaloidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physochlaina orientalis | 1 | 99.3% | 0.0 |
Database coverage of Candidate Physochlaina orientalisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solandra grandiflora | 1 | 99.3% | 0.0 |
Database coverage of Candidate Solandra grandifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum etuberosum | 4 | 99.2% | 0.0 |
Database coverage of Candidate Solanum etuberosumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Datura stramonium | 9 | 99.2% | 0.0 |
Database coverage of Candidate Datura stramoniumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Przewalskia tangutica | 3 | 99.2% | 0.0 |
Database coverage of Candidate Przewalskia tanguticaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicandra physalodes | 2 | 99.2% | 0.0 |
Database coverage of Candidate Nicandra physalodesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanaceae sp. YYL-2022 | 1 | 99.2% | 0.0 |
Database coverage of Candidate Solanaceae sp. YYL-2022This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Hyoscyamus muticus | 1 | 99.2% | 0.0 |
Database coverage of Candidate Hyoscyamus muticusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum palustre | 1 | 99.2% | 0.0 |
Database coverage of Candidate Solanum palustreThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum anomalostemon | 1 | 99.2% | 0.0 |
Database coverage of Candidate Solanum anomalostemonThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora caulescens | 1 | 99.2% | 0.0 |
Database coverage of Candidate Mandragora caulescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana repanda | 1 | 99.1% | 0.0 |
Database coverage of Candidate Nicotiana repandaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum rostratum | 2 | 99.1% | 0.0 |
Database coverage of Candidate Solanum rostratumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anisodus tanguticus | 1 | 99.1% | 0.0 |
Database coverage of Candidate Anisodus tanguticusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Datura metel | 3 | 99.1% | 0.0 |
Database coverage of Candidate Datura metelThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana stocktonii | 1 | 99.1% | 0.0 |
Database coverage of Candidate Nicotiana stocktoniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum sogarandinum | 2 | 99.0% | 0.0 |
Database coverage of Candidate Solanum sogarandinumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx australis | 1 | 99.0% | 0.0 |
Database coverage of Candidate Eriolarynx australisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum pennellii | 4 | 99.0% | 0.0 |
Database coverage of Candidate Solanum pennelliiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma ellipticum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma ellipticumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx lorentzii | 1 | 99.0% | 0.0 |
Database coverage of Candidate Eriolarynx lorentziiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania sp. | 1 | 99.0% | 0.0 |
Database coverage of Candidate Withania sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma lehmannii | 2 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma lehmanniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum neorickii | 2 | 99.0% | 0.0 |
Database coverage of Candidate Solanum neorickiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania adpressa | 2 | 99.0% | 0.0 |
Database coverage of Candidate Withania adpressaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma umbellatum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma umbellatumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum huaylasense | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum huaylasenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Saracha punctata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Saracha punctataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum corneliomulleri | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum corneliomulleriThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum peruvianum | 2 | 99.0% | 0.0 |
Database coverage of Candidate Solanum peruvianumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum chilense | 2 | 99.0% | 0.0 |
Database coverage of Candidate Solanum chilenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum triflorum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum triflorumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania riebeckii | 1 | 99.0% | 0.0 |
Database coverage of Candidate Withania riebeckiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania coagulans | 3 | 99.0% | 0.0 |
Database coverage of Candidate Withania coagulansThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma cyaneum | 2 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma cyaneumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma tingoanum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma tingoanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Acnistus arborescens x Iochroma cyaneum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Acnistus arborescens x Iochroma cyaneumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma nitidum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma nitidumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nolana spathulata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nolana spathulataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx fasciculata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Eriolarynx fasciculataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana otophora | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nicotiana otophoraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum lycopersicoides | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum lycopersicoidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Saracha nigribaccata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Saracha nigribaccataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum arcanum | 2 | 99.0% | 0.0 |
Database coverage of Candidate Solanum arcanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma salpoanum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma salpoanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anisodus acutangulus | 2 | 99.0% | 0.0 |
Database coverage of Candidate Anisodus acutangulusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum aligerum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum aligerumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dunalia obovata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Dunalia obovataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum chmielewskii | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum chmielewskiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum anamatophilum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum anamatophilumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma stenanthum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma stenanthumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum habrochaites | 5 | 99.0% | 0.0 |
Database coverage of Candidate Solanum habrochaitesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Atropanthe sinensis | 1 | 99.0% | 0.0 |
Database coverage of Candidate Atropanthe sinensisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum sitiens | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum sitiensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum nitidum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Solanum nitidumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma loxense | 1 | 99.0% | 0.0 |
Database coverage of Candidate Iochroma loxenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Acnistus arborescens | 1 | 99.0% | 0.0 |
Database coverage of Candidate Acnistus arborescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Trozelia umbellata | 1 | 99.0% | 0.0 |
Database coverage of Candidate Trozelia umbellataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Discopodium penninervium | 1 | 99.0% | 0.0 |
Database coverage of Candidate Discopodium penninerviumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania somnifera | 4 | 99.0% | 0.0 |
Database coverage of Candidate Withania somniferaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nolana albescens | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nolana albescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium pallidum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Lycium pallidumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Vassobia dichotoma | 1 | 99.0% | 0.0 |
Database coverage of Candidate Vassobia dichotomaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum medians | 10 | 98.8% | 0.0 |
Database coverage of Candidate Solanum mediansThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum canasense | 9 | 98.8% | 0.0 |
Database coverage of Candidate Solanum canasenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum x curtilobum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum x curtilobumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum morelliforme | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum morelliformeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Jaltomata sinuosa | 1 | 98.8% | 0.0 |
Database coverage of Candidate Jaltomata sinuosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum bulbocastanum | 7 | 98.8% | 0.0 |
Database coverage of Candidate Solanum bulbocastanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum andreanum | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum andreanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum berthaultii | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum berthaultiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum phureja | 5 | 98.8% | 0.0 |
Database coverage of Candidate Solanum phurejaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum stenotomum | 4 | 98.8% | 0.0 |
Database coverage of Candidate Solanum stenotomumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum tuberosum | 12 | 98.8% | 0.0 |
Database coverage of Candidate Solanum tuberosumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum wittmackii | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum wittmackiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum boliviense | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum bolivienseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum chomatophilum | 11 | 98.8% | 0.0 |
Database coverage of Candidate Solanum chomatophilumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum multiinterruptum | 9 | 98.8% | 0.0 |
Database coverage of Candidate Solanum multiinterruptumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum albornozii | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum albornoziiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum acroglossum | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum acroglossumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum marinasense | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum marinasenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum bukasovii | 15 | 98.8% | 0.0 |
Database coverage of Candidate Solanum bukasoviiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum cajamarquense | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum cajamarquenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum cardiophyllum | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum cardiophyllumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum ambosinum | 5 | 98.8% | 0.0 |
Database coverage of Candidate Solanum ambosinumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum megistacrolobum | 5 | 98.8% | 0.0 |
Database coverage of Candidate Solanum megistacrolobumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum raphanifolium | 8 | 98.8% | 0.0 |
Database coverage of Candidate Solanum raphanifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum chiquidenum | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum chiquidenumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum piurae | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum piuraeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum jamesii | 4 | 98.8% | 0.0 |
Database coverage of Candidate Solanum jamesiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum candolleanum | 11 | 98.8% | 0.0 |
Database coverage of Candidate Solanum candolleanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum paucissectum | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum paucissectumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum tarnii x Solanum tuberosum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum tarnii x Solanum tuberosumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum x juzepczukii | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum x juzepczukiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum aculeatissimum | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum aculeatissimumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum trifidum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum trifidumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum pinnatisectum | 4 | 98.8% | 0.0 |
Database coverage of Candidate Solanum pinnatisectumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Schraderanthus viscosus | 1 | 98.8% | 0.0 |
Database coverage of Candidate Schraderanthus viscosusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum limbaniense | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum limbanienseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum lignicaule | 4 | 98.8% | 0.0 |
Database coverage of Candidate Solanum lignicauleThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum leptophyes | 5 | 98.8% | 0.0 |
Database coverage of Candidate Solanum leptophyesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum ehrenbergii | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum ehrenbergiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium ferocissimum | 4 | 98.8% | 0.0 |
Database coverage of Candidate Lycium ferocissimumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis virginiana | 1 | 98.8% | 0.0 |
Database coverage of Candidate Physalis virginianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum stenophyllidium | 3 | 98.8% | 0.0 |
Database coverage of Candidate Solanum stenophyllidiumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum acaule | 5 | 98.8% | 0.0 |
Database coverage of Candidate Solanum acauleThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum achacachense | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum achacachenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum x blanco-galdosii | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum x blanco-galdosiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum stipuloideum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum stipuloideumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum hypacrarthrum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum hypacrarthrumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum tacnaense | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum tacnaenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Oryctes nevadensis | 1 | 98.8% | 0.0 |
Database coverage of Candidate Oryctes nevadensisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum huancabambense | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum huancabambenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum abancayense | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum abancayenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dunalia brachyacantha | 1 | 98.8% | 0.0 |
Database coverage of Candidate Dunalia brachyacanthaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum trisectum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum trisectumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum humectophilum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum humectophilumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania frutescens | 1 | 98.8% | 0.0 |
Database coverage of Candidate Withania frutescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum tarapatanum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum tarapatanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum ahanhuiri | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum ahanhuiriThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum augustii | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum augustiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum gracilifrons | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum gracilifronsThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum infundibuliforme | 2 | 98.8% | 0.0 |
Database coverage of Candidate Solanum infundibuliformeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum acroscopicum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum acroscopicumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum dolichocremastrum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum dolichocremastrumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis peruviana | 3 | 98.8% | 0.0 |
Database coverage of Candidate Physalis peruvianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum pachyandrum | 1 | 98.8% | 0.0 |
Database coverage of Candidate Solanum pachyandrumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum lycopersicum | 48 | 98.7% | 0.0 |
Database coverage of Candidate Solanum lycopersicumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum polyadenium | 3 | 98.7% | 0.0 |
Database coverage of Candidate Solanum polyadeniumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis philadelphica | 2 | 98.7% | 0.0 |
Database coverage of Candidate Physalis philadelphicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum ochranthum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum ochranthumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum gourlayi | 7 | 98.7% | 0.0 |
Database coverage of Candidate Solanum gourlayiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana sp. SH-2010 | 1 | 98.7% | 0.0 |
Database coverage of Candidate Nicotiana sp. SH-2010This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis cordata | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis cordataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum pimpinellifolium | 7 | 98.7% | 0.0 |
Database coverage of Candidate Solanum pimpinellifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum capsicoides | 2 | 98.7% | 0.0 |
Database coverage of Candidate Solanum capsicoidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum sparsipilum | 5 | 98.7% | 0.0 |
Database coverage of Candidate Solanum sparsipilumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum brevicaule | 12 | 98.7% | 0.0 |
Database coverage of Candidate Solanum brevicauleThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum salicifolium | 2 | 98.7% | 0.0 |
Database coverage of Candidate Solanum salicifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum cantense | 2 | 98.7% | 0.0 |
Database coverage of Candidate Solanum cantenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum paposanum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum paposanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum brachyantherum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum brachyantherumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum incamayoense | 5 | 98.7% | 0.0 |
Database coverage of Candidate Solanum incamayoenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum tweedianum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum tweedianumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis ixocarpa | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis ixocarpaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum virginianum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum virginianumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum annuum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum annuumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum lesteri | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum lesteriThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum salamancae | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum salamancaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Salpiglossis sinuata | 1 | 98.7% | 0.0 |
Database coverage of Candidate Salpiglossis sinuataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Jaltomata bicolor | 1 | 98.7% | 0.0 |
Database coverage of Candidate Jaltomata bicolorThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis minima | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis minimaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis pruinosa | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis pruinosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum remyanum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum remyanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum galapagense | 2 | 98.7% | 0.0 |
Database coverage of Candidate Solanum galapagenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum aureum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum aureumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum mochiquense | 2 | 98.7% | 0.0 |
Database coverage of Candidate Solanum mochiquenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis ampla | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis amplaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis angulata | 3 | 98.7% | 0.0 |
Database coverage of Candidate Physalis angulataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis sp. SH-2010 | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis sp. SH-2010This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum cheesmaniae | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum cheesmaniaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Physalis longifolia | 1 | 98.7% | 0.0 |
Database coverage of Candidate Physalis longifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Brugmansia arborea | 1 | 98.7% | 0.0 |
Database coverage of Candidate Brugmansia arboreaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum sanchez-vegae | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum sanchez-vegaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Solanum microdontum | 1 | 98.7% | 0.0 |
Database coverage of Candidate Solanum microdontumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KM025249 | Nicotiana sylvestris ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 2 | BK010737 | TPA_asm: Nicotiana knightiana chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 3 | AP019624 | Nicotiana tabacum apxA_T2_120719 chloroplast DNA, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 4 | OQ473890 | Nicotiana tabacum isolate PilotoCubano chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 5 | AP019623 | Nicotiana tabacum SR1_120719 chloroplast DNA, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 6 | MZ707522 | Nicotiana tabacum chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 7 | KU199713 | Nicotiana tabacum cultivar TN90 plastid, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 8 | NC_007500 | Nicotiana sylvestris chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 9 | NC_001879 | Nicotiana tabacum plastid, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 10 | OQ473888 | Nicotiana tabacum isolate Hainan2 chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 11 | OQ473889 | Nicotiana tabacum isolate Hainan3 chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 12 | AP019625 | Nicotiana tabacum apxC_T2_120719 chloroplast DNA, large circle chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 13 | BK010741 | TPA_asm: Nicotiana paniculata chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 14 | OQ473886 | Nicotiana tabacum isolate 7-CX14 chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 15 | OQ473887 | Nicotiana tabacum isolate 189802E-Habana2000 chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 16 | BK010738 | TPA_asm: Nicotiana rustica chloroplast, complete genome | 955 | 100.0% | 1873.73 | 0.00e+00 | 99.7% |
| 17 | NC_056979 | Nicotiana glauca chloroplast, complete genome | 955 | 100.0% | 1865.8 | 0.00e+00 | 99.6% |
| 18 | MG182422 | Nicotiana attenuata chloroplast, complete genome | 955 | 100.0% | 1865.8 | 0.00e+00 | 99.6% |
| 19 | JF419563 | Nicotiana attenuata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) mRNA, complete cds; chloroplast | 955 | 100.0% | 1865.8 | 0.00e+00 | 99.6% |
| 20 | NC_035952 | Nicotiana attenuata chloroplast, complete genome | 955 | 100.0% | 1865.8 | 0.00e+00 | 99.6% |
| 21 | BK010740 | TPA_asm: Nicotiana glauca chloroplast, complete genome | 955 | 100.0% | 1865.8 | 0.00e+00 | 99.6% |
| 22 | NC_056978 | Nicotiana suaveolens chloroplast, complete genome | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 23 | NC_056976 | Nicotiana amplexicaulis chloroplast, complete genome | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 24 | LT576836 | Nicotiana tabacum chloroplast rbcL gene for Rubisco large subunit, cultivar Petit-Havana | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 25 | LC617401 | Nicotiana benthamiana NbWT_20_0_01 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase, complete cds | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 26 | U08608 | Anthocercis viscosa chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 27 | J01450 | Nicotiana tabacum coupling factor beta-subunit gene, partial cds; and ribulose-1,5-biphosphate carboxylase/ oxygenase large subunit gene, complete cds; chloroplast genes for chloroplast products | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 28 | NC_056977 | Nicotiana debneyi chloroplast, complete genome | 955 | 100.0% | 1857.87 | 0.00e+00 | 99.5% |
| 29 | MT596796 | Plastid transformation vector pLEV IR-coS, complete sequence | 953 | 99.8% | 1853.91 | 0.00e+00 | 99.5% |
| 30 | D70815 | Nicotiana debneyi chloroplast rbcL gene for ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit, complete cds | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 31 | NC_029746 | Iochroma cardenasianum chloroplast, complete genome | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 32 | M16896 | Tobacco (N.acuminata) ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, complete cds | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 33 | KM360660 | Atropa belladonna ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 34 | NC_004561 | Atropa belladonna chloroplast, complete genome | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 35 | AY558863 | Cuscuta compacta ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 36 | PV078024 | Mandragora officinarum voucher personal collection:JeremyBechelli:04-SSU chloroplast, complete genome | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 37 | U08609 | Atropa belladonna chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 38 | PV078023 | Mandragora turcomanica voucher personal collection:JeremyBechelli:06-SSU chloroplast, complete genome | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 39 | LC649170 | Nicotiana plumbaginifolia YN25 chloroplast, complete genome | 955 | 100.0% | 1849.94 | 0.00e+00 | 99.4% |
| 40 | BK010739 | TPA_asm: Nicotiana obtusifolia chloroplast, complete genome | 952 | 99.7% | 1844.0 | 0.00e+00 | 99.4% |
| 41 | HQ216145 | Scopolia carniolica isolate Tu210 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; and rbcL-accD intergenic spacer, partial sequence; plastid | 929 | 97.3% | 1798.4 | 0.00e+00 | 99.4% |
| 42 | MH703713 | Mandragora officinarum isolate Jordan ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 929 | 97.3% | 1798.4 | 0.00e+00 | 99.4% |
| 43 | HQ216117 | Atropa belladonna isolate Tu169 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; and rbcL-accD intergenic spacer, partial sequence; plastid | 929 | 97.3% | 1798.4 | 0.00e+00 | 99.4% |
| 44 | FJ914178 | Atropa belladonna voucher H.Sun 9040 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 929 | 97.3% | 1798.4 | 0.00e+00 | 99.4% |
| 45 | MN218090 | Solanum sisymbriifolium isolate NN15 chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 46 | JN563930 | Synthetic construct Nicotiana undulata chloroplast clone pCK2-6, complete sequence | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 47 | MZ221862 | Solanum sisymbriifolium voucher E:Sarkinen et al. 4536 chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 48 | NC_030282 | Scopolia parviflora chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 49 | NC_062492 | Lycianthes radiata voucher E:Gonzales 2039 chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 50 | U08614 | Mandragora officinalis chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 51 | NC_016068 | Nicotiana undulata chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 52 | XM_033661133 | PREDICTED: Nicotiana tomentosiformis ribulose bisphosphate carboxylase large chain (LOC117281257), mRNA | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 53 | MW470952 | Anisodus luridus chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 54 | PV078025 | Mandragora autumnalis voucher personal collection:JeremyBechelli:03-SSU chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 55 | NC_007602 | Nicotiana tomentosiformis chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 56 | MH360735 | Hyoscyamus niger ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 57 | NC_061213 | Solanum sisymbriifolium chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 58 | NC_024261 | Hyoscyamus niger chloroplast, complete genome | 955 | 100.0% | 1842.01 | 0.00e+00 | 99.3% |
| 59 | MN262642 | Physochlaina physaloides chloroplast, complete genome | 954 | 99.9% | 1840.03 | 0.00e+00 | 99.3% |
| 60 | NC_044154 | Physochlaina orientalis chloroplast, complete genome | 954 | 99.9% | 1840.03 | 0.00e+00 | 99.3% |
| 61 | U08620 | Solandra grandiflora chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 952 | 99.7% | 1836.07 | 0.00e+00 | 99.3% |
| 62 | NC_041604 | Solanum etuberosum voucher PI 498311 plastid, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 63 | NC_063110 | Scopolia carniolica chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 64 | KM025251 | Nicotiana tomentosiformis ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 65 | U08611 | Datura stramonium chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 66 | MW324578 | Przewalskia tangutica chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 67 | MN165114 | Nicandra physalodes chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 68 | MZ221881 | Solanum etuberosum voucher E:Gardner et al. 111 chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 69 | MW042817 | Solanaceae sp. YYL-2022 cultivar Henan chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 70 | PP234564 | Przewalskia tangutica isolate p53 chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 71 | MZ450974 | Hyoscyamus muticus chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 72 | NC_036733 | Przewalskia tangutica chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 73 | NC_041622 | Solanum palustre voucher PI 245763 plastid, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 74 | U08615 | Nicandra physalodes chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 75 | ON509842 | Solanum etuberosum voucher PI 558288 chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 76 | OM638061 | Solanum etuberosum chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 77 | NC_062874 | Solanum anomalostemon voucher BM:Knapp 10364 chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 78 | NC_086882 | Mandragora caulescens chloroplast, complete genome | 955 | 100.0% | 1834.09 | 0.00e+00 | 99.2% |
| 79 | MT610897 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 80 | NC_056981 | Nicotiana repanda chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 81 | KT178123 | Solanum rostratum voucher Aust 178 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 82 | NC_018117 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 83 | MK347419 | Anisodus tanguticus chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 84 | MK244356 | Datura stramonium voucher QRI 540 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 85 | OK040953 | Datura metel chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 86 | NC_057245 | Solanum rostratum chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 87 | NC_056980 | Nicotiana stocktonii chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 88 | MT610896 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 89 | OM616889 | Datura stramonium isolate MSH-DS19 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 90 | JN662489 | Datura stramonium isolate NN003 chloroplast, complete genome | 955 | 100.0% | 1826.16 | 0.00e+00 | 99.1% |
| 91 | HM849947 | Datura stramonium ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 940 | 98.4% | 1804.35 | 0.00e+00 | 99.1% |
| 92 | KF022464 | Datura stramonium isolate 01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 938 | 98.2% | 1800.39 | 0.00e+00 | 99.1% |
| 93 | MH021551 | Solanum sogarandinum plastid, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 94 | NC_029833 | Iochroma australe chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 95 | KX086685 | Solanum pennellii isolate TGRC LA1272 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 96 | NC_030177 | Iochroma ellipticum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 97 | MN990084 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 98 | OR400641 | Eriolarynx lorentzii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 99 | OR426647 | Withania sp. chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 100 | KU310654 | Iochroma lehmannii plastid, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 101 | NC_026880 | Solanum neorickii isolate TS-146 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 102 | MG946933 | Withania adpressa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 103 | NC_030044 | Iochroma umbellatum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 104 | NC_062081 | Solanum huaylasense chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 105 | NC_026694 | Saracha punctata chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 106 | NC_062080 | Solanum corneliomuelleri chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 107 | NC_026881 | Solanum peruvianum isolate TS-404 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 108 | NC_026877 | Solanum chilense isolate TS-408 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 109 | KT178124 | Solanum triflorum voucher Aust 161 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 110 | LC487531 | Datura metel chloroplast rbcL gene, ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial sequence | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 111 | BK010849 | TPA_asm: Withania riebeckii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 112 | NC_069556 | Datura metel chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 113 | MT811797 | Solanum neorickii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 114 | MG946934 | Withania coagulans ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 115 | NC_030178 | Iochroma cyaneum voucher Smith 265 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 116 | NC_027177 | Iochroma tingoanum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 117 | NC_030056 | Acnistus arborescens x Iochroma cyaneum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 118 | NC_026567 | Iochroma nitidum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 119 | U08616 | Nolana spathulata chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 120 | NC_030167 | Iochroma lehmannii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 121 | NC_035742 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 122 | NC_030171 | Eriolarynx fasciculata chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 123 | M16867 | Tobacco (N.otophora) ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, complete cds | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 124 | KX086691 | Solanum lycopersicoides isolate TGRC LA2951 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 125 | BK010847 | TPA_asm: Withania adpressa chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 126 | MG946935 | Withania coagulans ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 127 | NC_027099 | Dunalia solanacea chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 128 | KX086696 | Solanum arcanum isolate TGRC LA2153 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 129 | NC_030168 | Iochroma salpoanum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 130 | HG975452 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 131 | NC_066481 | Anisodus acutangulus chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 132 | NC_062867 | Solanum aligerum voucher BM:Knapp et al. 10436 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 133 | NC_026563 | Dunalia obovata chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 134 | OQ473544 | Solanum chilense chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 135 | NC_062079 | Solanum chmielewskii chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 136 | NC_086523 | Solanum anamatophilum voucher CIP 761555 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 137 | NC_026574 | Iochroma stenanthum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 138 | OQ473540 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 139 | NC_044471 | Atropanthe sinensis chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 140 | KX086690 | Solanum sitiens isolate TGRC LA4115 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 141 | NC_062486 | Solanum nitidum voucher E:Sarkinen et al. 4851 chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 142 | NC_026726 | Iochroma loxense chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 143 | NC_062078 | Solanum arcanum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 144 | NC_030185 | Acnistus arborescens chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 145 | MN781973 | Anisodus acutangulus chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 146 | OR360843 | Trozelia umbellata chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 147 | OR400640 | Discopodium penninervium chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 148 | NC_047176 | Withania coagulans chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 149 | MK142783 | Withania somnifera chloroplast clone 154386, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 150 | KU306396 | Iochroma cyaneum chloroplast, complete genome | 955 | 100.0% | 1818.23 | 0.00e+00 | 99.0% |
| 151 | AB051021 | Nolana albescens chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase, partial cds | 953 | 99.8% | 1814.26 | 0.00e+00 | 99.0% |
| 152 | AB051025 | Lycium pallidum chloroplast rbcL gene for ribulose-1,5-bisphosphate cerboxylase/oxygenase, partial cds | 953 | 99.8% | 1814.26 | 0.00e+00 | 99.0% |
| 153 | KP294521 | Vassobia dichotoma chloroplast, complete genome | 952 | 99.7% | 1812.28 | 0.00e+00 | 99.0% |
| 154 | MZ221921 | Solanum medians voucher E:Gonzales et al. 9 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 155 | MH021451 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 156 | ON509847 | Solanum x curtilobum voucher PI 604207 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 157 | NC_086548 | Solanum morelliforme voucher CIP 764271 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 158 | NC_062863 | Jaltomata sinuosa chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 159 | OM638073 | Solanum bulbocastanum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 160 | MH021410 | Solanum andreanum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 161 | ON509711 | Solanum berthaultii voucher CIP 760257 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 162 | MH021545 | Solanum phureja plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 163 | NC_041607 | Solanum stenotomum voucher PI 320364 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 164 | OM638079 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 165 | NC_086524 | Solanum wittmackii voucher CIP 762077 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 166 | ON509750 | Solanum medians voucher CIP 761503 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 167 | NC_062870 | Solanum boliviense voucher CORD:Barboza et al. 3562 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 168 | NC_041603 | Solanum chomatophilum voucher PI 365328 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 169 | OR632701 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 170 | NC_041620 | Solanum multiinterruptum voucher PI 210044 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 171 | ON509811 | Solanum albornozii voucher CIP 763735 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 172 | MH021401 | Solanum acroglossum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 173 | MH021510 | Solanum marinasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 174 | NC_041625 | Solanum phureja voucher PI 195191 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 175 | MH021530 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 176 | MH021431 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 177 | OM638058 | Solanum cajamarquense chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 178 | MH021434 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 179 | MT120860 | Solanum bukasovii isolate BUK1 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 180 | NC_041621 | Solanum bukasovii f. multidissectum voucher PI 210052 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 181 | MK690622 | Solanum cardiophyllum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 182 | MH021432 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 183 | ON509782 | Solanum multiinterruptum voucher CIP 762407 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 184 | MH021449 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 185 | NC_041590 | Solanum albornozii voucher PI 498206 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 186 | NC_041591 | Solanum ambosinum voucher PI 365317 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 187 | MH021518 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 188 | ON509767 | Solanum chomatophilum voucher CIP 762055 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 189 | OM638069 | Solanum raphanifolium chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 190 | MH021437 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 191 | ON509766 | Solanum chiquidenum voucher CIP 762052 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 192 | NC_069602 | Solanum piurae chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 193 | NC_041613 | Solanum jamesii voucher PI 641944 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 194 | OM302453 | Solanum candolleanum voucher SC4-1 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 195 | ON509807 | Solanum candolleanum voucher CIP 763651 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 196 | OM638067 | Solanum paucissectum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 197 | NC_041588 | Solanum acroglossum voucher PI 365313 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 198 | NC_069604 | Solanum tarnii x Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 199 | OM638055 | Solanum bukasovii chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 200 | NC_050208 | Solanum x juzepczukii isolate JUZ chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 201 | PP234974 | Solanum aculeatissimum voucher LXP-13-07963 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 202 | ON509697 | Solanum tuberosum voucher CIP 703514 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 203 | MH021448 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 204 | ON509795 | Solanum chomatophilum voucher CIP 762615 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 205 | NC_086545 | Solanum trifidum voucher CIP 764145 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 206 | NC_041599 | Solanum cajamarquense voucher PI 230522 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 207 | NC_050207 | Solanum tuberosum subsp. andigenum isolate ADG1 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 208 | ON509824 | Solanum morelliforme voucher CIP 764293 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 209 | MH021566 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 210 | ON509775 | Solanum medians voucher CIP 762256 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 211 | NC_041626 | Solanum pinnatisectum voucher PI 253214 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 212 | OR360844 | Schraderanthus viscosus chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 213 | MH021519 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 214 | MH021438 | Solanum bulbocastanum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 215 | NC_041617 | Solanum limbaniense voucher PI 473468 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 216 | OM638066 | Solanum megistacrolobum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 217 | ON509754 | Solanum lignicaule voucher CIP 761652 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 218 | ON509751 | Solanum candolleanum voucher CIP 761510 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 219 | ON509685 | Solanum tuberosum voucher CIP 703308 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 220 | MH021435 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 221 | ON509763 | Solanum bulbocastanum voucher CIP 761933 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 222 | ON509691 | Solanum tuberosum voucher CIP 703433 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 223 | MH021506 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 224 | ON509757 | Solanum candolleanum voucher CIP 761739 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 225 | MH021447 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 226 | ON509768 | Solanum candolleanum voucher CIP 762068 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 227 | NC_069597 | Solanum chiquidenum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 228 | NC_086550 | Solanum ehrenbergii voucher PI 275216 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 229 | XM_059432982 | PREDICTED: Lycium ferocissimum ribulose bisphosphate carboxylase large chain (LOC132042439), mRNA | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 230 | ON509791 | Solanum cajamarquense voucher CIP 762608 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 231 | KT178121 | Physalis virginiana voucher Aust 157 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 232 | MH021433 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 233 | ON509770 | Solanum wittmackii voucher CIP 762093 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 234 | NC_041596 | Solanum stenophyllidium voucher PI 320265 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 235 | ON509792 | Solanum chomatophilum voucher CIP 762611 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 236 | ON509779 | Solanum acaule voucher CIP 762345 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 237 | ON509790 | Solanum chomatophilum voucher CIP 762576 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 238 | OM638050 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 239 | NC_041587 | Solanum achacachense voucher PI 558032 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 240 | OP056022 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 241 | OM638070 | Solanum raphanifolium chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 242 | ON509724 | Solanum medians voucher CIP 760415 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 243 | ON509759 | Solanum candolleanum voucher CIP 761827 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 244 | NC_041595 | Solanum x blanco-galdosii voucher PI 498214 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 245 | KX086697 | Solanum habrochaites isolate TGRC LA2196 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 246 | NC_041619 | Solanum megistacrolobum voucher PI 210034 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 247 | MH021408 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 248 | MT120867 | Solanum bukasovii isolate BUK2 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 249 | NC_068253 | Solanum raphanifolium voucher SR1 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 250 | NC_041610 | Solanum marinasense voucher PI 498255 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 251 | ON509802 | Solanum stipuloideum voucher CIP 763111 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 252 | ON509720 | Solanum candolleanum voucher CIP 760337 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 253 | MH021526 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 254 | NC_062506 | Solanum candolleanum voucher BM:Knapp et al. 10251 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 255 | MH021442 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 256 | MH021443 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 257 | ON509849 | Solanum tuberosum voucher PI 607886 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 258 | ON509704 | Solanum chomatophilum voucher CIP 760056 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 259 | ON509774 | Solanum medians voucher CIP 762218 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 260 | MH021446 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 261 | MH021570 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 262 | NC_041611 | Solanum hypacrarthrum voucher PI 473477 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 263 | MH021543 | Solanum phureja plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 264 | MT120862 | Solanum tuberosum subsp. andigenum isolate ADG2 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 265 | NC_041551 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 266 | OM638082 | Solanum tacnaense chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 267 | ON509844 | Solanum x juzepczukii voucher PI 599259 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 268 | OR360845 | Oryctes nevadensis chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 269 | XM_059436179 | PREDICTED: Lycium ferocissimum ribulose bisphosphate carboxylase large chain (LOC132045594), mRNA | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 270 | MH021404 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 271 | NC_086521 | Solanum huancabambense voucher CIP 760955 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 272 | ON509839 | Solanum tuberosum voucher PI 546023 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 273 | NC_041586 | Solanum abancayense voucher PI 458403 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 274 | MH021541 | Solanum phureja plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 275 | NC_026879 | Solanum habrochaites isolate TS-407 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 276 | ON509771 | Solanum multiinterruptum voucher CIP 762103 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 277 | OQ473543 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 278 | OM638052 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 279 | NC_026906 | Dunalia brachyacantha chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 280 | MZ233590 | Solanum pinnatisectum voucher SP-10 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 281 | NC_061388 | Solanum aculeatissimum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 282 | MH021493 | Solanum jamesii plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 283 | MH021539 | Solanum phureja plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 284 | MH021527 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 285 | ON509752 | Solanum chomatophilum voucher CIP 761551 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 286 | ON509834 | Solanum jamesii voucher PI 458424 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 287 | ON509740 | Solanum chiquidenum voucher CIP 761069 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 288 | NC_062469 | Solanum trisectum voucher HFN:974750147 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 289 | ON509793 | Solanum chomatophilum voucher CIP 762613 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 290 | ON509760 | Solanum candolleanum voucher CIP 761843 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 291 | OM638051 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 292 | NC_062502 | Solanum humectophilum voucher E:Sarkinen et al. 4625 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 293 | ON509749 | Solanum multiinterruptum voucher CIP 761424 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 294 | MG946936 | Withania frutescens ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 295 | NC_069607 | Solanum tarapatanum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 296 | NC_041598 | Solanum bukasovii voucher PI 266385 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 297 | ON509713 | Solanum boliviense voucher CIP 760279 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 298 | ON509755 | Solanum raphanifolium voucher CIP 761655 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 299 | ON509829 | Solanum raphanifolium voucher PI 296126 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 300 | ON509748 | Solanum boliviense voucher CIP 761384 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 301 | MH021547 | Solanum pinnatisectum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 302 | NC_041600 | Solanum canasense voucher PI 210035 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 303 | MH021525 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 304 | ON509781 | Solanum raphanifolium voucher CIP 762358 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 305 | NC_007943 | Solanum bulbocastanum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 306 | MH021520 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 307 | ON509741 | Solanum piurae voucher CIP 761072 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 308 | NC_050205 | Solanum ahanhuiri isolate AJH chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 309 | NC_086525 | Solanum augustii voucher CIP 762633 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 310 | ON509794 | Solanum chomatophilum voucher CIP 762614 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 311 | MN866909 | Lycium ferocissimum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 312 | ON509843 | Solanum x juzepczukii voucher PI 595438 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 313 | MH021406 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 314 | ON509764 | Solanum candolleanum voucher CIP 762001 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 315 | ON509705 | Solanum chomatophilum voucher CIP 760057 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 316 | MH021411 | Solanum andreanum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 317 | NC_069599 | Solanum gracilifrons chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 318 | NC_041592 | Solanum andreanum voucher PI 320345 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 319 | OQ473541 | Solanum peruvianum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 320 | NC_069600 | Solanum infundibuliforme chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 321 | ON509805 | Solanum multiinterruptum voucher CIP 763491 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 322 | ON509700 | Solanum ahanhuiri voucher CIP 706209 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 323 | MH021569 | Solanum stenophyllidium plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 324 | OM638075 | Solanum pinnatisectum chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 325 | ON509722 | Solanum raphanifolium voucher CIP 760351 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 326 | MH021461 | Solanum chomatophilum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 327 | NC_041589 | Solanum acroscopicum voucher PI 365314 plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 328 | MT984233 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 329 | MH021567 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 330 | MH021407 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 331 | ON509756 | Solanum raphanifolium voucher CIP 761683 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 332 | MH021421 | Solanum stenophyllidium plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 333 | MH021505 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 334 | NC_069606 | Solanum tacnaense chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 335 | NC_086526 | Solanum dolichocremastrum voucher CIP 762998 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 336 | MK690624 | Solanum jamesii chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 337 | ON509690 | Solanum tuberosum voucher CIP 703421 chloroplast, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 338 | MH021524 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 1810.3 | 0.00e+00 | 98.8% |
| 339 | AM235152 | Lycium ferocissimum chloroplast partial rbcL gene for ribulose bisphosphate carboxylase large subunit, specimen voucher Balele K. 5 (NBG) | 954 | 99.9% | 1808.32 | 0.00e+00 | 98.8% |
| 340 | OP028208 | Physalis peruviana chloroplast, complete genome | 952 | 99.7% | 1804.35 | 0.00e+00 | 98.8% |
| 341 | NC_026570 | Physalis peruviana plastid, complete genome | 952 | 99.7% | 1804.35 | 0.00e+00 | 98.8% |
| 342 | NC_062488 | Solanum pachyandrum voucher BM:Sarkinen et al. 4546 chloroplast, complete genome | 952 | 99.7% | 1804.35 | 0.00e+00 | 98.8% |
| 343 | KY887588 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 344 | OQ473547 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 345 | MH021549 | Solanum polyadenium plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 346 | NC_070364 | Physalis philadelphica chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 347 | KX086688 | Solanum ochranthum isolate TGRC LA2161 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 348 | OQ473536 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 349 | MH021473 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 350 | AB586586 | Nicotiana sp. SH-2010 chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, isolate: T077 | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 351 | NC_072167 | Physalis cordata chloroplast, complete sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 352 | NC_041618 | Solanum medians voucher PI 210045 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 353 | LC613092 | Solanum lycopersicum CMS[P] chloroplast DNA, contig: CMS-PCp054, partial sequence | 955 | 100.0% | 3604.74 | 0.00e+00 | 98.7% |
| 354 | ON509733 | Solanum polyadenium voucher CIP 760726 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 355 | NC_026882 | Solanum pimpinellifolium isolate TS-415 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 356 | ON203960 | Solanum capsicoides chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 357 | MH021554 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 358 | OQ473538 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 359 | ON509717 | Solanum brevicaule voucher CIP 760324 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 360 | NC_062481 | Solanum salicifolium voucher HFN:s.n. chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 361 | NC_041628 | Solanum sogarandinum voucher PI 230510 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 362 | MH021523 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 363 | KX086703 | Solanum lycopersicum ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 364 | KX086693 | Solanum lycopersicum isolate TGRC LA1320 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 365 | AC239738 | Solanum lycopersicum strain Heinz 1706 chromosome 1 clone hba-240p19 map 1, complete sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 366 | MT811791 | Solanum lycopersicum cultivar PDS chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 367 | OQ473542 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 368 | OQ473549 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 369 | ON509718 | Solanum brevicaule voucher CIP 760327 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 370 | NC_062511 | Solanum cantense voucher BM:Sarkinen et al. 4079 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 371 | OQ473532 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 372 | LC613093 | Solanum lycopersicum CMS[P] chloroplast DNA, contig: CMS-PCp055, partial sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 373 | NC_062489 | Solanum paposanum voucher BM:Sarkinen et al. 4091 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 374 | NC_062871 | Solanum brachyantherum voucher E:Baines et al. 56 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 375 | OR166175 | Withania somnifera chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 376 | MH021514 | Solanum medians plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 377 | ON509806 | Solanum candolleanum voucher CIP 763648 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 378 | NC_041629 | Solanum sparsipilum voucher PI 246536 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 379 | OQ473534 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 380 | MH021488 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 381 | MH019242 | Physalis peruviana chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 382 | MT811790 | Solanum lycopersicum cultivar Corbarino chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 383 | MH021516 | Solanum medians plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 384 | MH021428 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 385 | MZ221859 | Solanum salicifolium voucher BM:Knapp 10492 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 386 | MH021478 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 387 | ON509723 | Solanum lignicaule voucher CIP 760353 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 388 | MH021491 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 389 | LC613099 | Solanum lycopersicum O chloroplast DNA, contig: OCp002, partial sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 390 | NC_062471 | Solanum tweedianum voucher CORD:Barboza 2229 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 391 | OQ473545 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 392 | OQ473527 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 393 | KP331414 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 394 | MH021489 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 395 | ON509761 | Solanum bulbocastanum voucher CIP 761896 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 396 | ON509708 | Solanum brevicaule voucher CIP 760235 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 397 | NC_041601 | Solanum cardiophyllum voucher PI 283062 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 398 | MH021553 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 399 | OQ473533 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 400 | OQ473526 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 401 | MH021471 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 402 | MG946905 | Withania somnifera ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 403 | OQ473537 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 404 | NC_085278 | Physalis ixocarpa chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 405 | KX086702 | Solanum lycopersicum isolate UIB 1-30 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 406 | LC613090 | Solanum lycopersicum CMS[MSA1] chloroplast DNA, contig: CMS-MSA1Cp001, partial sequence | 955 | 100.0% | 3604.74 | 0.00e+00 | 98.7% |
| 407 | NC_041624 | Solanum paucissectum voucher PI 473489 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 408 | MT973500 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 409 | MG946897 | Solanum virginianum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 410 | OQ473529 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 411 | MH021513 | Solanum medians plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 412 | OQ473539 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 413 | OQ473521 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 414 | NC_062873 | Solanum annuum voucher CORD:Barboza 3017 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 415 | MH021444 | Solanum canasense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 416 | NC_086547 | Solanum lesteri voucher CIP 764266 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 417 | MH021427 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 418 | NC_062480 | Solanum salamancae voucher CORD:Barboza 2182 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 419 | U08618 | Salpiglossis sinuata chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 420 | MN192191 | Physalis philadelphica cultivar Wild chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 421 | KX086701 | Solanum lycopersicum isolate UIB 1-48 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 422 | NC_062508 | Solanum capsicoides voucher E:Sarkinen et al. 4547 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 423 | ON509826 | Solanum medians voucher PI 265872 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 424 | NC_007898 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 425 | NC_062862 | Jaltomata bicolor voucher E:Gonzales 2880 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 426 | MH021529 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 427 | LC613091 | Solanum lycopersicum CMS[O] chloroplast DNA, contig: CMS-OCp001, partial sequence | 955 | 100.0% | 3604.74 | 0.00e+00 | 98.7% |
| 428 | MH021454 | Solanum cardiophyllum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 429 | PP471919 | Physalis minima isolate R2 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 430 | NC_039458 | Physalis pruinosa chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 431 | ON509747 | Solanum lignicaule voucher CIP 761212 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 432 | HG975525 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 433 | ON509836 | Solanum brevicaule voucher PI 473065 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 434 | OQ473530 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 435 | OM638077 | Solanum sparsipilum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 436 | NC_062477 | Solanum remyanum voucher E:Baines et al. 115 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 437 | ON509830 | Solanum infundibuliforme voucher PI 458324 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 438 | LC613098 | Solanum lycopersicum O chloroplast DNA, contig: OCp001, partial sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 439 | NC_041627 | Solanum polyadenium voucher PI 161728 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 440 | LC613095 | Solanum pimpinellifolium LA1670 chloroplast DNA, contig: LA1670Cp001, partial sequence | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 441 | KX086699 | Solanum galapagense isolate TGRC LA0930 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 442 | MH021490 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 443 | OR166174 | Withania somnifera chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 444 | ON509719 | Solanum brevicaule voucher CIP 760328 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 445 | ON509706 | Solanum brevicaule voucher CIP 760230 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 446 | MT811792 | Solanum lycopersicum cultivar Piennolo giallo chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 447 | OQ473524 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 448 | ON509762 | Solanum bulbocastanum voucher CIP 761898 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 449 | NC_026878 | Solanum galapagense isolate TS-208 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 450 | KY887587 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 451 | OQ473522 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 452 | OQ473528 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 453 | ON509772 | Solanum cantense voucher CIP 762130 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 454 | NC_041616 | Solanum leptophyes voucher PI 458378 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 455 | LC613103 | Solanum lycopersicum Sekai-ichi chloroplast DNA, contig: Sekai-ichiCp001, partial sequence | 955 | 100.0% | 3604.74 | 0.00e+00 | 98.7% |
| 456 | MH021511 | Solanum marinasense plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 457 | NC_062421 | Solanum aureum voucher E:Balls 5826 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 458 | MH021470 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 459 | OQ473546 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 460 | MH021436 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 461 | ON509799 | Solanum mochiquense voucher CIP 762989 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 462 | MH021504 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 463 | ON509701 | Solanum paucissectum voucher CIP 760007 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 464 | NC_062718 | Solanum mochiquense voucher SM1-3 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 465 | OR296714 | Physalis ampla chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 466 | MH045574 | Physalis angulata chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 467 | JF772171 | Solanum tuberosum isolate RH89-039-16 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 468 | AB586587 | Physalis sp. SH-2010 chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, isolate: T964 | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 469 | KX086692 | Solanum pimpinellifolium isolate TGRC LA0114 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 470 | NC_026876 | Solanum cheesmaniae isolate TS-199 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 471 | KP117024 | Solanum lycopersicum isolate TS-321 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 472 | OP748222 | Physalis longifolia var. subglabrata chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 473 | OQ473548 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 474 | MH021424 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 475 | MH021507 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 476 | MT811798 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 477 | LC613100 | Solanum lycopersicum P chloroplast DNA, contig: PCp001, partial sequence | 955 | 100.0% | 3604.74 | 0.00e+00 | 98.7% |
| 478 | OQ473531 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 479 | NC_081500 | Brugmansia arborea chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 480 | MH021555 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 481 | OQ473525 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 482 | NC_069601 | Solanum lignicaule chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 483 | NC_041606 | Solanum gourlayi voucher PI 472911 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 484 | MH021426 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 485 | AM087200 | Solanum lycopersicum complete chloroplast genome, cultivar IPA-6 | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 486 | OQ473535 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 487 | OM257167 | Physalis angulata var. villosa chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 488 | MH021423 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 489 | MH021469 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 490 | MH021439 | Solanum bulbocastanum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 491 | MH021425 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 492 | NC_041612 | Solanum incamayoense voucher PI 473060 plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 493 | MH021468 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 494 | NC_062482 | Solanum sanchez-vegae voucher E:Gonzales 2389 chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 495 | OQ473523 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 496 | MH021590 | Solanum microdontum plastid, complete genome | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.7% |
| 497 | L14403 | Lycopersicon esculentum chloroplast ribulosebisphosphate carboxylase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 1802.37 | 0.00e+00 | 98.6% |
| 498 | NC_039457 | Physalis angulata chloroplast, complete genome | 955 | 100.0% | 1800.39 | 0.00e+00 | 98.6% |
| 499 | LC613096 | Solanum lycopersicum var. cerasiforme LA1673 chloroplast DNA, contig: LA1673Cp001, partial sequence | 955 | 100.0% | 3573.02 | 0.00e+00 | 98.5% |
| 500 | LC613102 | Solanum acaule chloroplast DNA, contig: SacauleCp001, partial sequence | 955 | 100.0% | 3388.67 | 0.00e+00 | 97.3% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Nicotiana tabacum | species | Nicotiana tabacum | Nicotiana tabacum | AP019624 | 0.997 |
Database coverage of Taxon of Interest Nicotiana tabacumThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Nicotiana tabacum
Flag 5.1A:
The reference data supports this taxon well
28 records
There are 28 sequences in the reference database for Nicotiana tabacum at the given locus rbcL.
Global occurrence records for Nicotiana tabacum.
Database coverage of species in genus Nicotiana
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL Database coverage of species in genus Nicotiana that occur in country of origin Indonesia
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |